mirror of
https://github.com/NixOS/nixpkgs.git
synced 2025-07-13 21:50:33 +03:00
Merge master into staging-next
This commit is contained in:
commit
1c4183d88a
12 changed files with 115 additions and 31 deletions
|
@ -565,7 +565,7 @@ Names of files and directories should be in lowercase, with dashes between words
|
|||
|
||||
- Do not use tab characters, i.e. configure your editor to use soft tabs. For instance, use `(setq-default indent-tabs-mode nil)` in Emacs. Everybody has different tab settings so it’s asking for trouble.
|
||||
|
||||
- Use `lowerCamelCase` for variable names, not `UpperCamelCase`. Note, this rule does not apply to package attribute names, which instead follow the rules in [](#sec-package-naming).
|
||||
- Use `lowerCamelCase` for variable names, not `UpperCamelCase`. Note, this rule does not apply to package attribute names, which instead follow the rules in [package naming](./pkgs/README.md#package-naming).
|
||||
|
||||
- Function calls with attribute set arguments are written as
|
||||
|
||||
|
|
|
@ -19356,6 +19356,11 @@
|
|||
github = "ymeister";
|
||||
githubId = 47071325;
|
||||
};
|
||||
ymstnt = {
|
||||
name = "YMSTNT";
|
||||
github = "ymstnt";
|
||||
githubId = 21342713;
|
||||
};
|
||||
yoavlavi = {
|
||||
email = "yoav@yoavlavi.com";
|
||||
github = "yoav-lavi";
|
||||
|
|
|
@ -103,9 +103,9 @@ in
|
|||
};
|
||||
|
||||
bantime = mkOption {
|
||||
default = null;
|
||||
type = types.nullOr types.str;
|
||||
example = "10m";
|
||||
default = "10m";
|
||||
type = types.str;
|
||||
example = "1h";
|
||||
description = lib.mdDoc "Number of seconds that a host is banned.";
|
||||
};
|
||||
|
||||
|
|
|
@ -1,26 +1,62 @@
|
|||
{ lib, stdenv, fetchFromGitHub, cmake, tbb, zlib, python3, perl }:
|
||||
{ lib
|
||||
, stdenv
|
||||
, fetchFromGitHub
|
||||
, cmake
|
||||
, perl
|
||||
, python3
|
||||
, tbb
|
||||
, zlib
|
||||
, runCommand
|
||||
, bowtie2
|
||||
}:
|
||||
|
||||
stdenv.mkDerivation rec {
|
||||
stdenv.mkDerivation (finalAttrs: {
|
||||
pname = "bowtie2";
|
||||
version = "2.5.2";
|
||||
|
||||
src = fetchFromGitHub {
|
||||
owner = "BenLangmead";
|
||||
repo = pname;
|
||||
rev = "v${version}";
|
||||
sha256 = "sha256-Bem4SHY/74suZPDbw/rwKMLBn3bRq5ooHbBoVnKuYk0=";
|
||||
repo = "bowtie2";
|
||||
rev = "refs/tags/v${finalAttrs.version}";
|
||||
fetchSubmodules = true;
|
||||
hash = "sha256-rWeopeYuCk9ZhJX2SFCcxZWcjXjjTiVRiwkzLQcIgd0=";
|
||||
};
|
||||
|
||||
# because of this flag, gcc on aarch64 cannot find the Threads
|
||||
# Could NOT find Threads (missing: Threads_FOUND)
|
||||
# TODO: check with other distros and report upstream
|
||||
postPatch = ''
|
||||
substituteInPlace CMakeLists.txt \
|
||||
--replace "-m64" ""
|
||||
'';
|
||||
|
||||
nativeBuildInputs = [ cmake ];
|
||||
|
||||
buildInputs = [ tbb zlib python3 perl ];
|
||||
|
||||
cmakeFlags = lib.optional (!stdenv.hostPlatform.isx86) ["-DCMAKE_CXX_FLAGS=-I${finalAttrs.src}/third_party"];
|
||||
|
||||
# ctest fails because of missing dependencies between tests
|
||||
doCheck = false;
|
||||
|
||||
passthru.tests = {
|
||||
ctest = runCommand "${finalAttrs.pname}-test" { } ''
|
||||
mkdir $out
|
||||
${lib.getExe bowtie2} -x ${finalAttrs.src}/example/index/lambda_virus ${finalAttrs.src}/example/reads/longreads.fq -u 10
|
||||
${bowtie2}/bin/bowtie2-build-s -c GGGCGGCGACCTCGCGGGTTTTCGCTA $out/small
|
||||
${bowtie2}/bin/bowtie2-inspect-s $out/small
|
||||
${bowtie2}/bin/bowtie2-build-l -c GGGCGGCGACCTCGCGGGTTTTCGCTA $out/large
|
||||
${bowtie2}/bin/bowtie2-inspect-l $out/large
|
||||
'';
|
||||
};
|
||||
|
||||
meta = with lib; {
|
||||
description = "An ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences";
|
||||
license = licenses.gpl3;
|
||||
license = licenses.gpl3Plus;
|
||||
homepage = "http://bowtie-bio.sf.net/bowtie2";
|
||||
changelog = "https://github.com/BenLangmead/bowtie2/releases/tag/${finalAttrs.src.rev}";
|
||||
maintainers = with maintainers; [ rybern ];
|
||||
platforms = platforms.all;
|
||||
broken = stdenv.isAarch64; # only x86 is supported
|
||||
mainProgram = "bowtie2";
|
||||
};
|
||||
}
|
||||
})
|
||||
|
|
41
pkgs/by-name/hi/hifile/package.nix
Normal file
41
pkgs/by-name/hi/hifile/package.nix
Normal file
|
@ -0,0 +1,41 @@
|
|||
{ lib, appimageTools, fetchurl }:
|
||||
|
||||
let
|
||||
version = "0.9.9.5";
|
||||
pname = "hifile";
|
||||
|
||||
src = fetchurl {
|
||||
url = "https://www.hifile.app/files/HiFile-${version}.AppImage";
|
||||
hash = "sha256-Ks/NLPm5loo9q8pT0LdtfcrC38203beNE74sbEpyuJM=";
|
||||
};
|
||||
|
||||
appimageContents = appimageTools.extractType2 {
|
||||
inherit pname version src;
|
||||
};
|
||||
|
||||
in
|
||||
appimageTools.wrapType2 rec {
|
||||
inherit pname version src;
|
||||
|
||||
extraInstallCommands = ''
|
||||
mv $out/bin/${pname}-${version} $out/bin/${pname}
|
||||
|
||||
install -m 444 -D ${appimageContents}/HiFile.desktop $out/share/applications/HiFile.desktop
|
||||
install -m 444 -D ${appimageContents}/HiFile.png $out/share/icons/hicolor/512x512/apps/HiFile.png
|
||||
substituteInPlace $out/share/applications/HiFile.desktop \
|
||||
--replace 'Exec=HiFile' 'Exec=${pname}'
|
||||
'';
|
||||
|
||||
meta = with lib; {
|
||||
description = "Dual-pane graphical file manager for Windows, macOS and Linux";
|
||||
longDescription = ''
|
||||
HiFile is the next evolution of file managers. Its mission is to increase your productivity whenever you work with files or folders. It aims to be better in every way - more convenient, more versatile, more efficient, more elegant, more customizable, and more fun.
|
||||
'';
|
||||
homepage = "https://www.hifile.app/";
|
||||
downloadPage = "https://www.hifile.app/download";
|
||||
license = licenses.unfree;
|
||||
sourceProvenance = with sourceTypes; [ binaryNativeCode ];
|
||||
maintainers = with maintainers; [ ymstnt ];
|
||||
platforms = [ "x86_64-linux" ];
|
||||
};
|
||||
}
|
|
@ -17,13 +17,13 @@
|
|||
assert lib.elem lineEditingLibrary [ "isocline" "readline" ];
|
||||
stdenv.mkDerivation (finalAttrs: {
|
||||
pname = "trealla";
|
||||
version = "2.28.12";
|
||||
version = "2.29.36";
|
||||
|
||||
src = fetchFromGitHub {
|
||||
owner = "trealla-prolog";
|
||||
repo = "trealla";
|
||||
rev = "v${finalAttrs.version}";
|
||||
hash = "sha256-uWCpCjYFtK2pNeHHZWhWI6YZ+cllQpkKz//nHracl5s=";
|
||||
hash = "sha256-tQp2DOBW71Wm1aQqspW9tuH8aM8ir+ilZiENdElB/+0=";
|
||||
};
|
||||
|
||||
postPatch = ''
|
||||
|
|
|
@ -2,11 +2,11 @@
|
|||
|
||||
stdenvNoCC.mkDerivation rec {
|
||||
pname = "flix";
|
||||
version = "0.40.0";
|
||||
version = "0.41.0";
|
||||
|
||||
src = fetchurl {
|
||||
url = "https://github.com/flix/flix/releases/download/v${version}/flix.jar";
|
||||
sha256 = "sha256-NVQY2TgIR9ROy4x8PWxCjuaOkNx0bcUA4oZHjpQbHc4=";
|
||||
sha256 = "sha256-bDeqwk+grkCxmGE9H8Ks7Q8KvLxNCzaLe44DlR6E7YE=";
|
||||
};
|
||||
|
||||
dontUnpack = true;
|
||||
|
|
|
@ -9,14 +9,14 @@
|
|||
|
||||
buildPythonPackage rec {
|
||||
pname = "wallbox";
|
||||
version = "0.4.14";
|
||||
version = "0.5.1";
|
||||
format = "setuptools";
|
||||
|
||||
disabled = pythonOlder "3.7";
|
||||
|
||||
src = fetchPypi {
|
||||
inherit pname version;
|
||||
hash = "sha256-HKlq5DPG3HD9i9LLTJdlzEFim+2hBdSfKl43BojhEf8=";
|
||||
hash = "sha256-EDEB7/CkrfYSNcSh55Itrj6rThsNKeuj8lHLAY+Qml4=";
|
||||
};
|
||||
|
||||
propagatedBuildInputs = [
|
||||
|
|
|
@ -15,16 +15,16 @@ let
|
|||
in
|
||||
rustPlatform.buildRustPackage rec {
|
||||
pname = "texlab";
|
||||
version = "5.10.0";
|
||||
version = "5.10.1";
|
||||
|
||||
src = fetchFromGitHub {
|
||||
owner = "latex-lsp";
|
||||
repo = "texlab";
|
||||
rev = "refs/tags/v${version}";
|
||||
hash = "sha256-MTWaGgDIDo3CaRHyHWqliKsPdbU/TZPsyfF7SoHTnhk=";
|
||||
hash = "sha256-ACdiFkV138jDIrRe+baYo+r9vCO4cyRyO2ck7OKakFY=";
|
||||
};
|
||||
|
||||
cargoHash = "sha256-8Vrp4d5luf91pKpUC4wWn4otsanqopCHwCjcnfTzyLk=";
|
||||
cargoHash = "sha256-bEeQOOucXd4HNTR6SmidAfDkZ1tT7ORmUxrNx+3FNRw=";
|
||||
|
||||
outputs = [ "out" ] ++ lib.optional (!isCross) "man";
|
||||
|
||||
|
@ -41,7 +41,7 @@ rustPlatform.buildRustPackage rec {
|
|||
# generate the man page
|
||||
postInstall = lib.optionalString (!isCross) ''
|
||||
# TexLab builds man page separately in CI:
|
||||
# https://github.com/latex-lsp/texlab/blob/v5.9.2/.github/workflows/publish.yml#L117-L121
|
||||
# https://github.com/latex-lsp/texlab/blob/v5.10.1/.github/workflows/publish.yml#L117-L121
|
||||
help2man --no-info "$out/bin/texlab" > texlab.1
|
||||
installManPage texlab.1
|
||||
'';
|
||||
|
|
|
@ -68,7 +68,7 @@
|
|||
mipsel-linux = import ./bootstrap-files/mipsel-unknown-linux-gnu.nix;
|
||||
mips64el-linux = import
|
||||
(if localSystem.isMips64n32
|
||||
then ./bootstrap-files/mips64el-unknown-linux-gnuabin32.nix.nix
|
||||
then ./bootstrap-files/mips64el-unknown-linux-gnuabin32.nix
|
||||
else ./bootstrap-files/mips64el-unknown-linux-gnuabi64.nix);
|
||||
powerpc64le-linux = import ./bootstrap-files/powerpc64le-unknown-linux-gnu.nix;
|
||||
riscv64-linux = import ./bootstrap-files/riscv64-unknown-linux-gnu.nix;
|
||||
|
|
|
@ -2,13 +2,13 @@
|
|||
|
||||
buildGoModule rec {
|
||||
pname = "syft";
|
||||
version = "0.92.0";
|
||||
version = "0.93.0";
|
||||
|
||||
src = fetchFromGitHub {
|
||||
owner = "anchore";
|
||||
repo = pname;
|
||||
rev = "v${version}";
|
||||
hash = "sha256-YmzizpcAfE4+Rfq5ydQnDQBo4R+pAyudfi+fqD9EZP0=";
|
||||
hash = "sha256-e8d+CK7rRbyHeRHOjK3tGFIBHuosdV4AMetUQar54E4=";
|
||||
# populate values that require us to use git. By doing this in postFetch we
|
||||
# can delete .git afterwards and maintain better reproducibility of the src.
|
||||
leaveDotGit = true;
|
||||
|
@ -22,7 +22,7 @@ buildGoModule rec {
|
|||
};
|
||||
# hash mismatch with darwin
|
||||
proxyVendor = true;
|
||||
vendorHash = "sha256-siOZWhHqNokkYAPwuXQCs4T1yBiEWUTJzhfbH/Z2uBk=";
|
||||
vendorHash = "sha256-BUCe2v80tHAqMBwa6xae3ZOTOok8msM6hFh6d9D4xZA=";
|
||||
|
||||
nativeBuildInputs = [ installShellFiles ];
|
||||
|
||||
|
|
|
@ -1,17 +1,17 @@
|
|||
{ lib, mkDerivation, fetchFromGitHub, substituteAll, udev, stdenv
|
||||
{ lib, wrapQtAppsHook, fetchFromGitHub, substituteAll, udev, stdenv
|
||||
, pkg-config, qtbase, cmake, zlib, kmod, libXdmcp, qttools, qtx11extras, libdbusmenu
|
||||
, withPulseaudio ? stdenv.isLinux, libpulseaudio
|
||||
, withPulseaudio ? stdenv.isLinux, libpulseaudio, quazip
|
||||
}:
|
||||
|
||||
mkDerivation rec {
|
||||
version = "0.5.0";
|
||||
stdenv.mkDerivation rec {
|
||||
version = "0.6.0";
|
||||
pname = "ckb-next";
|
||||
|
||||
src = fetchFromGitHub {
|
||||
owner = "ckb-next";
|
||||
repo = "ckb-next";
|
||||
rev = "v${version}";
|
||||
sha256 = "sha256-yR1myagAqavAR/7lPdufcrJpPmXW7r4N4pxTMF6NbuE=";
|
||||
hash = "sha256-G0cvET3wMIi4FlBmaTkdTyYtcdVGzK4X0C2HYZr43eg=";
|
||||
};
|
||||
|
||||
buildInputs = [
|
||||
|
@ -22,9 +22,11 @@ mkDerivation rec {
|
|||
qttools
|
||||
qtx11extras
|
||||
libdbusmenu
|
||||
quazip
|
||||
] ++ lib.optional withPulseaudio libpulseaudio;
|
||||
|
||||
nativeBuildInputs = [
|
||||
wrapQtAppsHook
|
||||
pkg-config
|
||||
cmake
|
||||
];
|
||||
|
|
Loading…
Add table
Add a link
Reference in a new issue